Dnah9<em1Hmd> Endonuclease-mediated Allele Detail MGI Mouse (MGI:6720876)

About Help FAQ

Dnah9^em1Hmd
Endonuclease-mediated Allele Detail

Summary | Mutation origin | Mutation description | Phenotypes | Find Mice (IMSR) | References

Summary

Symbol:	Dnah9^em1Hmd
Name:	dynein, axonemal, heavy chain 9; endonuclease-mediated mutation 1, Hiroshi Hamada
MGI ID:	MGI:6720876
Synonyms:	Dnah9^-
Gene:	Dnah9 Location: Chr11:65722150-66059379 bp, - strand Genetic Position: Chr11, 40.53 cM
Alliance:	Dnah9^em1Hmd page

Mutation
origin

Strain of Origin:

C57BL/6

Mutation
description

Allele Type:		Endonuclease-mediated (Null/knockout)
Mutation:		Intragenic deletion
		Mutation details: Exon 30 was targeted with two sgRNAs (targeting TCAGACATAGAAGTGCGAGATGG and GATCGATCTTACAGCTTGTCTGG) using CRISPR/Cas9 technology, resulting in the deletion of the exon. (J:301033)

Phenotypes

View phenotypes and curated references for all genotypes (concatenated display).

Find Mice (IMSR)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available Cell Lines: 0 lines available
Carrying any Dnah9 Mutation:	233 strains or lines available

References

Original:	J:301033 Ide T, et al., CFAP53 regulates mammalian cilia-type motility patterns through differential localization and recruitment of axonemal dynein components. PLoS Genet. 2020 Dec;16(12):e1009232
All:	1 reference(s)

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24