Foxi3em2(cre/ERT2)Akg
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Foxi3em2(cre/ERT2)Akg |
| Name: |
forkhead box I3; endonuclease-mediated mutation 2, Andrew K Groves |
| MGI ID: |
MGI:7522306 |
| Synonyms: |
Foxi3CreER |
| Gene: |
Foxi3 Location: Chr6:70933590-70938050 bp, + strand Genetic Position: Chr6, 32.14 cM
|
| Alliance: |
Foxi3em2(cre/ERT2)Akg page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Inducible, Null/knockout, Recombinase, Reporter) |
| Inducer: |
|
tamoxifen |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Foxi3em2(cre/ERT2)Akg expression driven by
1 gene
Knock-in expression driven by:
|
| |
|
Mutation details: Using CRISPR/cas9 genome editing, the entire coding sequence of the forkhead box I3 (Foxi3 locus on chromosome 6) was replaced with a (from 5' to 3') CreERT2 fusion cDNA, P2A peptide sequence followed by enhanced green fluorescent protein (eGFP), a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), a polyA signal, and a PGK-neo resistance cassette. This entire construct was electroporated, with CRISPR-assisted targeting vectors (gRNA CCCCCGGGATGGCTCTGATATA), in embryonic stem (ES) cells.
(J:339365)
|
|
|
|
Activity: |
 Tissue activity of this recombinase allele
|
|
Driver:
|
Foxi3
(mouse)
|
| |
|
|
|
|
| Original: |
J:339365 Ankamreddy H, et al., Foxi3(GFP) and Foxi3(CreER) mice allow identification and lineage labeling of pharyngeal arch ectoderm and endoderm, and tooth and hair placodes. Dev Dyn. 2023 Aug 6; |
| All: |
2 reference(s) |
|
Analysis Tools
