Cfap57<em1Qsh> Endonuclease-mediated Allele Detail MGI Mouse (MGI:7529021)

Cfap57^em1Qsh
Endonuclease-mediated Allele Detail

Summary

Symbol:	Cfap57^em1Qsh
Name:	cilia and flagella associated protein 57; endonuclease-mediated mutation 1, Qinghua Shi
MGI ID:	MGI:7529021
Synonyms:	Cfap57^M
Gene:	Cfap57 Location: Chr4:118411748-118477974 bp, - strand Genetic Position: Chr4, 54.84 cM
Alliance:	Cfap57^em1Qsh page

Mutation
origin

Strain of Origin:

C57BL/6

Mutation
description

Allele Type:		Endonuclease-mediated (Humanized sequence, Null/knockout)
Mutation:		Intragenic deletion
		Mutation details: Exon 18 was targeted with an sgRNA (targeting GGTCCTCTTCGCTTAAATACTAG) using CRISPR/Cas9 technology, resulting in a 7 bp deletion (GAAGCGA) that leads to a frameshift and premature stop codon (NM_026789.5:c.2865-2871del, p.K956Ffs4). This mutation essentially mimics the human c.2872C>T (p.R958) mutation associated with male infertility. (J:333969)

Phenotypes

View phenotypes and curated references for all genotypes (concatenated display).

Disease models

Expression

In Structures Affected by this Mutation:

Find Mice (IMSR)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 0 strains available Cell Lines: 0 lines available
Carrying any Cfap57 Mutation:	87 strains or lines available

References

Original:	J:333969 Ma A, et al., Loss-of-function mutations in CFAP57 cause multiple morphological abnormalities of the flagella in humans and mice. JCI Insight. 2023 Feb 8;8(3)
All:	1 reference(s)

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24