Abhd17b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Abhd17b^em1(IMPC)J
• Name: abhydrolase domain containing 17B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5696235
• Synonyms: Abhd17b^em1J
• Gene: Abhd17b Location: Chr19:21630549-21663001 bp, + strand Genetic Position: Chr19, 15.54 cM
• Alliance: Abhd17b^em1(IMPC)J page
• IMPC: Abhd17b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Abhd17b-7064J-M4843 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, GTCATTAAACCTATTTGGGA, TTTCAAGAACCCTCCCAAAT, ATGCTGCATAAGTTATACTG, and GTATAACTTATGCAGCATAA, which resulted in a 632 bp deletion in intron 2 beginning at Chromosome 19 positive strand position 21,678,217 bp, ATTTGGGAGGGTTCTTGAAATTATA, and ending after TGGTTTTTACCCTTATGCTGCA at 21,678,848 bp (GRCm38/mm10) in intron 3. This mutation deletes exon 2 and the splice acceptor and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Abhd17b Mutation: 43 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)