Tex15^em1Jcs
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tex15^em1Jcs
• Name: testis expressed gene 15 meiosis and synapsis associated; endonuclease-mediated mutation 1, John C Schimenti
• MGI ID: MGI:5804172
• Synonyms: Tex15^T2181I
• Gene: Tex15 Location: Chr8:34006766-34075610 bp, + strand Genetic Position: Chr8, 20.59 cM
• Alliance: Tex15^em1Jcs page

Mutation origin

• Strain of Origin: FVB/NJ x B6(Cg)-Tyr^c-2J/J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Using an sgRNA (targeting AGTTTCCACGTATATTGACT) and ssODN template (AACTTACAGGCGTTAAAAGGCTTCTGAATAACTCTAAGTATTCAGTTTCCATATATATTGACTTGGTGCCACATACTGCATCTGTAAATTTTGGAAACACTGTGGCAGAATTAGAACATAACTACA) with CRISPR/Cas9 technology, threonine codon 2188 (ACG) was changed to isoleucine (ATA) (c.6563_6564delCGinsTA, p.T2188I). This is the equivalent of the human p.T2181I mutation caused by SNP rs61735519. (J:226562)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tex15 Mutation: 114 strains or lines available

References

• Original: J:226562 Singh P, et al., The genetics of human infertility by functional interrogation of SNPs in mice. Proc Natl Acad Sci U S A. 2015 Aug 18;112(33):10431-6
• All: 1 reference(s)