Iigp1c^{em1(IMPC)Hmgu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Iigp1c^{em1(IMPC)Hmgu}
• Name: interferon inducible GTPase 1C; endonuclease-mediated mutation 2, Helmholtz Zentrum Muenchen GmbH
• MGI ID: MGI:6158427
• Gene: Iigp1c Location: Chr18:60345152-60380892 bp, + strand Genetic Position: Chr18, 34.36 cM
• Alliance: Iigp1c^{em1(IMPC)Hmgu} page
• IMPC: Iigp1c gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Helmholtz-Zentrum Muenchen by injecting CAS9 RNA and 2 guide sequences TAGATCAGGTAGATCAGGTGAGG, GGTGAGAGCAACATTGAGCGGGG, which resulted in a Exon Deletion. (J:237616)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Iigp1c Mutation: 16 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)