Npffr2^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Npffr2^em1(IMPC)Bay
• Name: neuropeptide FF receptor 2; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6257641
• Gene: Npffr2 Location: Chr5:89675288-89731599 bp, + strand Genetic Position: Chr5, 44.32 cM
• Alliance: Npffr2^em1(IMPC)Bay page
• IMPC: Npffr2 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 RNA and 2 guide sequences CCATGAGCGAGAAATGGGACTCA, TTGCTGGACAACATCATAGCAGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Npffr2 Mutation: 24 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)