Metrn^em1(IMPC)Ics
Endonuclease-mediated Allele Detail

Summary

• Symbol: Metrn^em1(IMPC)Ics
• Name: meteorin, glial cell differentiation regulator; endonuclease-mediated mutation 1, Mouse Clinical Institute
• MGI ID: MGI:6273961
• Gene: Metrn Location: Chr17:26013545-26016019 bp, - strand Genetic Position: Chr17, 12.89 cM, cytoband A3.3
• Alliance: Metrn^em1(IMPC)Ics page
• IMPC: Metrn gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Institut Clinique de la Souris by injecting CAS9 RNA, 2 guide sequences CCTGCTCTTTTCCTAAACCGAAT, TGCGTTTCCTCAGTTCCAAGTGG, and a non-contributing oligo, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Metrn Mutation: 19 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 1 reference(s)