Hook1em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
Symbol: |
Hook1em2(IMPC)Tcp |
Name: |
hook microtubule tethering protein 1; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
MGI ID: |
MGI:6316189 |
Gene: |
Hook1 Location: Chr4:95855477-95913650 bp, + strand Genetic Position: Chr4, 44.17 cM, cytoband C5
|
Alliance: |
Hook1em2(IMPC)Tcp page
|
IMPC: |
Hook1 gene page |
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project TCPR858 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of ATGTTCTCCGGACAAAAATG and GTTCCATCAGCGACATAGGC targeting the 5' side and ACATTGCTAGTTCTCGATGC and GCCACTGACCTCCAGAATAT targeting the 3' side leading to a 1597-bp deletion from Chr4:95991796 to 95993392; 10-bp deletion Chr4: 95991707 to 95991716 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts.
(J:200814)
|
|
|
|
Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
All: |
1 reference(s) |
|