Pogz^em1(IMPC)Ics
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pogz^em1(IMPC)Ics
• Name: pogo transposable element with ZNF domain; endonuclease-mediated mutation 1, Mouse Clinical Institute
• MGI ID: MGI:6336152
• Gene: Pogz Location: Chr3:94744878-94789637 bp, + strand Genetic Position: Chr3, 40.74 cM
• Alliance: Pogz^em1(IMPC)Ics page
• IMPC: Pogz gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Institut Clinique de la Souris by injecting CAS9 RNA and 2 guide sequences CCTGCCTATGAAGTGCCCAGCAT, GAGTTGGGTGACGCTTAAGTTGG, which resulted in a Exon Deletion. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pogz Mutation: 54 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 1 reference(s)