AI467606^em1Ciphe
Endonuclease-mediated Allele Detail

Summary

• Symbol: AI467606^em1Ciphe
• Name: expressed sequence AI467606; endonuclease-mediated mutation 1, Centre d'ImmunoPhenomique
• MGI ID: MGI:6357866
• Gene: AI467606 Location: Chr7:126690531-126693158 bp, + strand Genetic Position: Chr7, 69.32 cM
• Alliance: AI467606^em1Ciphe page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 2 was targeted with sgRNAs (targeting GCTCCCTGAGCCTACAGCGGAGG and AGCGTGCCCCCACCCTAGTCTGG) using CRISPR/Cas9 technology, resulting in a 197 bp deletion in the 5' end of the CDS in exon 2. (J:82809, J:282407)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any AI467606 Mutation: 14 strains or lines available

References

• Original: J:82809 European Mouse Mutant Archive, Information obtained from the European Mouse Mutant Archive (EMMA). Unpublished. 2003-2013
• All: 2 reference(s)