Hsfy2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hsfy2^em1(IMPC)J
• Name: heat shock transcription factor, Y-linked 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6357916
• Gene: Hsfy2 Location: Chr1:56675203-56676594 bp, - strand Genetic Position: Chr1, 28.72 cM, cytoband C1
• Alliance: Hsfy2^em1(IMPC)J page
• IMPC: Hsfy2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AACCATCACTCATCTTCTTG and GGATATGGCTGAAGCACCTT, which resulted in a 1177 bp deletion beginning at Chromosome 1 position 56,636,197 bp and ending after 56,637,373 bp (GRCm38/mm10). This mutation deletes 1177 bp from ENSMUSE00000411336 (exon 1) and is predicted to cause a change of amino acid sequence after residue 2 and truncation 18 amino acids later by read through into the 3-prime UTR. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Hsfy2 Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)