About   Help   FAQ
Amigo2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Amigo2em1(IMPC)J
Name: adhesion molecule with Ig like domain 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6380687
Gene: Amigo2  Location: Chr15:97142006-97145168 bp, - strand  Genetic Position: Chr15, 52.91 cM
Alliance: Amigo2em1(IMPC)J page
IMPC: Amigo2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTTGTGGCATCCACTTAGC and TTGACAGCTCTAGGCAGGGT, which resulted in a 1531 bp deletion beginning at Chromosome 15 position 97,244,981 bp and ending after 97,246,511 bp (GRCm38/mm10). This mutation deletes 1531 bp of ENSMUSE00000505071 (exon 2) and is predicted to cause a change of amino acid sequence after residue 9 and early truncation 23 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Amigo2 Mutation:  25 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/05/2024
MGI 6.24
The Jackson Laboratory