Kpna6^{em1(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kpna6^{em1(IMPC)Wtsi}
• Name: karyopherin subunit alpha 6; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
• MGI ID: MGI:6382780
• Gene: Kpna6 Location: Chr4:129537773-129566560 bp, - strand Genetic Position: Chr4, 63.28 cM, cytoband D2.3
• Alliance: Kpna6^{em1(IMPC)Wtsi} page
• IMPC: Kpna6 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated
• Mutation: Single point mutation
• Mutation details: This allele from IMPC was generated at Welcome Sanger Institute by injecting CAS9 RNA, the guide sequence TCCTGCTTCAATGACAATTTTGG, and a donor oligo, which resulted in a Point Mutation allele. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Kpna6 Mutation: 43 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 1 reference(s)