Pdzd8^em1Kei
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pdzd8^em1Kei
• Name: PDZ domain containing 8; endonuclease-mediated mutation 1, Keiichi I Nakayama
• MGI ID: MGI:6515784
• Synonyms: Pdzd8^-
• Gene: Pdzd8 Location: Chr19:59285610-59334212 bp, - strand Genetic Position: Chr19, 54.65 cM
• Alliance: Pdzd8^em1Kei page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 1 was targeted with two sgRNAs (targeting GCAGGCCGAGGGTTGCGGCGGGG and GCAGATTCCCAGCACGACCCTGG) and crRNA and tracrRNA using CRISPR/Cas9 technology. Immunohistochemistry confirmed the lack of peptide expression from this allele in brain. (J:296912)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pdzd8 Mutation: 60 strains or lines available

References

• Original: J:296912 Shirane M, et al., Protrudin and PDZD8 contribute to neuronal integrity by promoting lipid extraction required for endosome maturation. Nat Commun. 2020 Sep 11;11(1):4576
• All: 3 reference(s)