Cimip4^em1Yingz
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cimip4^em1Yingz
• Name: ciliary microtubule inner protein 4; endonuclease-mediated mutation 1, Ying Zheng
• MGI ID: MGI:6728101
• Synonyms: Tex33^-
• Gene: Cimip4 Location: Chr15:78262600-78280112 bp, - strand Genetic Position: Chr15, 37.45 cM, cytoband E2
• Alliance: Cimip4^em1Yingz page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exons 2-4 were targeted with two sgRNAs (targeting TACCAGAATCATCTAGTCCCTGG and GCTAGCCAAGGCCAACACCTGGG) using CRISPR/Cas9 technology, resulting in the deletion of the exons. (J:306891)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cimip4 Mutation: 14 strains or lines available

References

• Original: J:306891 Xia M, et al., Testis-expressed protein 33 is not essential for spermiogenesis and fertility in mice. Mol Med Rep. 2021 May;23(5)
• All: 1 reference(s)