Ccdc87^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc87^em1(IMPC)J
• Name: coiled-coil domain containing 87; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6755465
• Gene: Ccdc87 Location: Chr19:4889394-4892556 bp, + strand Genetic Position: Chr19, 4.11 cM
• Alliance: Ccdc87^em1(IMPC)J page
• IMPC: Ccdc87 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCTCAAGCCGATTTACCAC and GTGAGTAGTGGGAGTATTCC, which resulted in a 2506 bp deletion beginning at Chromosome 19 position 4,889,552 bp and ending after 4,892,057 bp (GRCm39/mm39). This mutation deletes 2506 bp from ENSMUSE00000553699 (exon 1) coding sequence and is predicted to cause a change of amino acid sequence after residue 14 and termination 22 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ccdc87 Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)