Bahd1^em1Ggw
Endonuclease-mediated Allele Detail

Summary

• Symbol: Bahd1^em1Ggw
• Name: bromo adjacent homology domain containing 1; endonuclease-mediated mutation 1, Gang Greg Wang
• MGI ID: MGI:6763425
• Synonyms: Bahd1^W659G
• Gene: Bahd1 Location: Chr2:118730858-118755009 bp, + strand Genetic Position: Chr2, 59.72 cM
• Alliance: Bahd1^em1Ggw page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: Exon 5 was targeted with a gRNA (targeting GCCTGTAATACCACAGG) and an ssODN (CTAGCCATGACCTCTTCTCTTGTCCCCTAGGAGAGCTGATGATGAGCCTCCTGGGCTATTACAGGCCTGAGCACTTACAGGGAGGTCGCAGCCCCAGCATGCATGAGG) to change codon 659 from tryptophan (TGG) to glycine (GGC) (p.W659G). (J:309976)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Bahd1 Mutation: 37 strains or lines available

References

• Original: J:309976 Fan H, et al., A conserved BAH module within mammalian BAHD1 connects H3K27me3 to Polycomb gene silencing. Nucleic Acids Res. 2021 May 7;49(8):4441-4455
• All: 1 reference(s)