Ghr^em1Liang
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ghr^em1Liang
• Name: growth hormone receptor; endonuclease-mediated mutation 1, Gousheng Liang
• MGI ID: MGI:6830928
• Synonyms: Ghr^f
• Gene: Ghr Location: Chr15:3347237-3612834 bp, - strand Genetic Position: Chr15, 1.84 cM
• Alliance: Ghr^em1Liang page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: Using CRISPR/cas9 genome editing, guide RNAs (TACAAGTGGGAATTAATCTG and ACCCATCTTCTAGTTATGAA) and oligo donor DNAs are designed to introduce a loxP sites flanking exons 4a and 4b. (J:274377)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ghr Mutation: 49 strains or lines available

References

• Original: J:274377 Fang F, et al., Growth hormone acts on liver to stimulate autophagy, support glucose production, and preserve blood glucose in chronically starved mice. Proc Natl Acad Sci U S A. 2019 Apr 9;116(15):7449-7454
• All: 1 reference(s)