Kif1a^em8Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kif1a^em8Lutzy
• Name: kinesin family member 1A; endonuclease-mediated mutation 8, Cathleen Lutz
• MGI ID: MGI:6865775
• Synonyms: Kif1a cKO
• Gene: Kif1a Location: Chr1:92943186-93029673 bp, - strand Genetic Position: Chr1, 46.74 cM, cytoband E1-E2
• Alliance: Kif1a^em8Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: CRISPR/cas9 genome editing uses guide RNAs (GTGAGTCCATCCCAATGAGA, CTTTGCCCCTCTCATTGGGA, ACTCTGCCCTAATCACCTGA, and TCAACTCAGAGTGACCCTTC) to target exon 3. Donor DNAs including loxP sites were created 160 bp upstream of exon 3 and 120 bp downstream of exon 3. LoxP insertion sites are separated by 363bp. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Kif1a Mutation: 95 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 3 reference(s)