Mlh1em4Jcs
Endonuclease-mediated Allele Detail
|
Symbol: |
Mlh1em4Jcs |
Name: |
mutL homolog 1; endonuclease-mediated mutation 4, John C Schimenti |
MGI ID: |
MGI:7276205 |
Synonyms: |
Mlh1K618T |
Gene: |
Mlh1 Location: Chr9:111057296-111100854 bp, - strand Genetic Position: Chr9, 60.92 cM
|
Alliance: |
Mlh1em4Jcs page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
Mutation: |
|
Single point mutation
|
|
|
Mutation details: Using an sgRNA (targeting AGGACGACGGCCCGAAGGAA) and an ssODN template (AAGTGGCTGGACAGAGGACGACGGCCCGAAAGAGGGCCTTGCAGAGTACATTGTTGAGTTTCTGAAGAAGACAGCGGAGATGCTTGCAGACTATTTCTCTGTGGAGATCGATGAGGCGAG) with CRISPR/Cas9 technology, lysine codon 622 (AAA) was changed to threonine (ACA) (c.1865A>C, p.K622T). This is the equivalent of the human p.K618T mutation.
(J:324056)
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Mlh1 Mutation: |
42 strains or lines available
|
|
Original: |
J:324056 Singh P, et al., Human MLH1/3 variants causing aneuploidy, pregnancy loss, and premature reproductive aging. Nat Commun. 2021 Aug 18;12(1):5005 |
All: |
1 reference(s) |
|