Sec61g^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sec61g^em1(IMPC)J
• Name: SEC61 translocon subunit gamma; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7311993
• Gene: Sec61g Location: Chr11:16451638-16458484 bp, - strand Genetic Position: Chr11, 9.41 cM
• Alliance: Sec61g^em1(IMPC)J page
• IMPC: Sec61g gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, TGACATGGTTCCTATAACAA and GTACATCTAATTCCTCATTG, which resulted in a 4057 bp deletion beginning at Chromosome 11 position 16,454,576 bp and ending after 16,458,632 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001287615, ENSMUSE00001286315, ENSMUSE00000681061 (exons 1,2 and 3) and 3473 bp of intronic sequence including the start site, splice acceptors and donors and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Sec61g Mutation: 14 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)