Rr44606^em1Ddu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr44606^em1Ddu
• Name: regulatory region 44606; endonuclease-mediated mutation 1, Denis Duboule
• MGI ID: MGI:7327111
• Synonyms: deltaCB3
• Gene: Rr44606 Location: Chr2:74524401-74524800 bp, . strand Genetic Position: Chr2, Syntenic
• Alliance: Rr44606^em1Ddu page

Mutation origin

• Strain of Origin: C57BL/6 x CBA

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: Using an sgRNA (targeting TGATCTCTAGGCGGCGCTCG) with CRISPR/Cas9 technology, a 42 bp deletion (CTCACCCGCGAGCGCCGCCTAGAGATCAGTAAGAGCGTTAAC) was created in this Hoxd CTCF binding site region in Hoxd10 exon 2. (J:319862)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr44606 Mutation: 0 strains or lines available

References

• Original: J:319862 Amandio AR, et al., Sequential in cis mutagenesis in vivo reveals various functions for CTCF sites at the mouse HoxD cluster. Genes Dev. 2021 Nov 1;35(21-22):1490-1509
• All: 1 reference(s)