About   Help   FAQ
4933405L10Rikem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: 4933405L10Rikem1(IMPC)J
Name: RIKEN cDNA 4933405L10 gene; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7328446
Gene: 4933405L10Rik  Location: Chr8:106434921-106436877 bp, + strand  Genetic Position: Chr8, 53.04 cM, cytoband D2
Alliance: 4933405L10Rikem1(IMPC)J page
IMPC: 4933405L10Rik gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, CTAAGGCGAACAGCCTTCTG and GCTGGTCGTGTGGATCAGTG, which resulted in a 2081 bp deletion beginning at Chromosome 8 position 105,708,250 bp and ending after 105,710,330 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000214417, ENSMUSE00000214420, ENSMUSE00000214418 and ENSMUSE00000214419 (exons 1, 2, 3 and 4) and 867 bp of intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any 4933405L10Rik Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory