Rr231598^em1Smun
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr231598^em1Smun
• Name: regulatory region 231598; endonuclease-mediated mutation 1, Stefan Mundlos
• MGI ID: MGI:7407309
• Synonyms: deltaC2
• Gene: Rr231598 Location: Chr11:111795001-111796000 bp, . strand Genetic Position: Chr11, Syntenic
• Alliance: Rr231598^em1Smun page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The CTCF-binding site in the Sox9 topologically associated domain (TAD) was targeted with an sgRNA (targeting TGTAAGTGGGCATTGCCACC) using CRISPR/Cas9 technology, resulting in its deletion. (J:282642)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr231598 Mutation: 0 strains or lines available

References

• Original: J:282642 Despang A, et al., Functional dissection of the Sox9-Kcnj2 locus identifies nonessential and instructive roles of TAD architecture. Nat Genet. 2019 Aug;51(8):1263-1271
• All: 1 reference(s)