Cyp2w1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cyp2w1^em1(IMPC)J
• Name: cytochrome P450, family 2, subfamily w, polypeptide 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7413932
• Gene: Cyp2w1 Location: Chr5:139338372-139342788 bp, + strand Genetic Position: Chr5, 78.44 cM
• Alliance: Cyp2w1^em1(IMPC)J page
• IMPC: Cyp2w1 gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTCCCTAGTACCAATCCAAG and GCCCACTCCAGGTATTCACA, which resulted in a 1837 bp deletion beginning at Chromosome 5 position 139,354,049 bp and ending after 139,355,885 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000189900, ENSMUSE00000391270, and ENSMUSE00000685698 (exons 3,4, and 5) and 1355 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 117 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cyp2w1 Mutation: 12 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)