Del(9Rr207839-Rr207840)9Vmc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(9Rr207839-Rr207840)9Vmc
• Name: deletion, Chr 9, Vincent M Christoffels 9
• MGI ID: MGI:7423617
• Synonyms: RE6-8^-
• Gene: Del(9Rr207839-Rr207840)9Vmc Location: unknown Genetic Position: Chr9, Syntenic

Mutation origin

• Strain of Origin: FVB/NRj

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Del(9Rr207839-Rr207840)9Vmc involves 2 genes/genome features (Rr207839, Rr207840) View all
• Mutation details: The super-enhancer between Exog and Scn5a, containing cardiac-specific Scn5a enhancers Rr207838, Rr207839 and Rr207840, was targeted with sgRNAs (targeting GGCACTATTTGAGTTCCACT and GGGAGCCGAGGGCGCTCCTT) using CRISPR/Cas9 technology, resulting in an ~9.9 kb deletion of the sequence containing Rr207839 and Rr207840. (J:281596)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(9Rr207839-Rr207840)9Vmc Mutation: 0 strains or lines available

References

• Original: J:281596 Man JCK, et al., An enhancer cluster controls gene activity and topology of the SCN5A-SCN10A locus in vivo. Nat Commun. 2019 Oct 30;10(1):4943
• All: 1 reference(s)