Dus1l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dus1l^em1(IMPC)J
• Name: dihydrouridine synthase 1 like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7428761
• Gene: Dus1l Location: Chr11:120680027-120687229 bp, - strand Genetic Position: Chr11, 84.54 cM, cytoband E2
• Alliance: Dus1l^em1(IMPC)J page
• IMPC: Dus1l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCTGGGTATTGGTGCACAT and ACTGTTGGTTCTCGACAGGA, which resulted in a 434 bp deletion beginning at Chromosome 11 position 120,794,790 bp and ending after 120,795,223 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001238047 (exon 3) and 325 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 16 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dus1l Mutation: 16 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)