Ranbp3lem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Ranbp3lem1(IMPC)J |
Name: |
RAN binding protein 3-like; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7447006 |
Gene: |
Ranbp3l Location: Chr15:8997433-9067417 bp, + strand Genetic Position: Chr15, 3.82 cM
|
Alliance: |
Ranbp3lem1(IMPC)J page
|
IMPC: |
Ranbp3l gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTAGGCAAAAAGTGAGCAG and CCAGCTGTCCAACATCAGAG, which resulted in a 561 bp deletion beginning at Chromosome 15 position 9,007,125 bp and ending after 9,007,685 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001434081 (exon 7) and 418 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 138 and early truncation 2 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|