Ttc12em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Ttc12em1(IMPC)J |
Name: |
tetratricopeptide repeat domain 12; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7450833 |
Gene: |
Ttc12 Location: Chr9:49348263-49397525 bp, - strand Genetic Position: Chr9, 26.83 cM
|
Alliance: |
Ttc12em1(IMPC)J page
|
IMPC: |
Ttc12 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAAGGGTAGACAGTATCGT and GCTGGGCCAAACTAGAAAAC, which resulted in a 321 bp deletion beginning at Chromosome 9 position 49,470,103 bp and ending after 49,470,423 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001296287 (exon 6) and 199 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 106 and early truncation 15 amino acids later. There is a 5 bp insertion (TCACT) at the deletion site.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|