Tgm7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tgm7^em1(IMPC)J
• Name: transglutaminase 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7450838
• Gene: Tgm7 Location: Chr2:120924046-120946877 bp, - strand Genetic Position: Chr2, 60.37 cM
• Alliance: Tgm7^em1(IMPC)J page
• IMPC: Tgm7 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGAACTGTTAGCTAACAAA and TAGATTTTGTTGCTAGCCTC, which resulted in a 417 bp deletion beginning at Chromosome 2 position 121,106,807 bp and ending after 121,107,223 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000684906 (exon 4) and 298 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 146 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tgm7 Mutation: 36 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)