Guf1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Guf1^em1(IMPC)J
• Name: GUF1 homolog, GTPase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7450840
• Gene: Guf1 Location: Chr5:69714255-69731995 bp, + strand Genetic Position: Chr5, 37.13 cM
• Alliance: Guf1^em1(IMPC)J page
• IMPC: Guf1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATACAGAATCATTATTACAG and TGTCCAGTGGACATGGTATG, which resulted in a 377 bp deletion beginning at Chromosome 5 position 69,561,071 bp and ending after 69,561,447 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001240940 (exon 7) and 312 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 206 and early truncation 4 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Guf1 Mutation: 43 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)