Gabpb2em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
Symbol: |
Gabpb2em1(IMPC)Tcp |
Name: |
GA repeat binding protein, beta 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics |
MGI ID: |
MGI:7512906 |
Gene: |
Gabpb2 Location: Chr3:95089077-95125227 bp, - strand Genetic Position: Chr3, 40.74 cM, cytoband F2
|
Alliance: |
Gabpb2em1(IMPC)Tcp page
|
IMPC: |
Gabpb2 gene page |
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGGATCTTACACGGATTGAA targeting the 5' side and ATGGCCTCGTACACGCAACC targeting the 3' side of a critical region (ENSMUSE00000494767 and ENSMUSE00001271433). This resulted in a 3959-bp deletion of Chr3 from 95107302 to 95111260 (GRCm39) introducing a frameshift and premature stop codon.
(J:265051)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
All: |
1 reference(s) |
|