Klhl35^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Klhl35^em1(IMPC)J
• Name: kelch-like 35; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7532657
• Gene: Klhl35 Location: Chr7:99115211-99123229 bp, + strand Genetic Position: Chr7, 54.07 cM, cytoband F1
• Alliance: Klhl35^em1(IMPC)J page
• IMPC: Klhl35 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATCACACCAGACAATGCCGC and GAGGTATTAGGATTATTACA, which resulted in a 719 bp deletion beginning at Chromosome 7 position 99,469,893 bp and ending after 99,470,611 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000264947 (exon 3) and 534 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 285 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Klhl35 Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)