Fam110aem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Fam110aem1(IMPC)J |
Name: |
family with sequence similarity 110, member A; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7539173 |
Gene: |
Fam110a Location: Chr2:151811318-151822096 bp, - strand Genetic Position: Chr2, 74.83 cM
|
Alliance: |
Fam110aem1(IMPC)J page
|
IMPC: |
Fam110a gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAGTGGAACCAGAACCCAG and GGTCCCCGCCCACTACTGGA, which resulted in a 1930 bp deletion beginning at Chromosome 2 position 151,969,166 bp and ending after 151,971,095 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000681879 (exon 2) and 430 bp of flanking intronic sequence including the start site and splice acceptor and donor and is predicted to result in a null allele.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|