Pik3cd^em1Stgt
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pik3cd^em1Stgt
• Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta; endonuclease-mediated mutation 1, Stuart G Tangye
• MGI ID: MGI:7539174
• Synonyms: Pik3cd^E1020K, Pik3cd GOF
• Gene: Pik3cd Location: Chr4:149733625-149787023 bp, - strand Genetic Position: Chr4, 80.15 cM
• Alliance: Pik3cd^em1Stgt page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Glutamic acid codon 1020 (GAA) in exon 22 was changed to lysine (AAA) (p.E1020K) using an sgRNA (targeting GAGCTTCGTTGAACTTCACCCGG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.E1021K gain-of-function (GOF) mutation associated with PASLI (p110delta-activating mutations causing senescent T cells, lymphadenopathy, and immunodeficiency) disease. (J:292599)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pik3cd Mutation: 43 strains or lines available

References

• Original: J:292599 Avery DT, et al., Germline-activating mutations in PIK3CD compromise B cell development and function. J Exp Med. 2018 Aug 6;215(8):2073-2095
• All: 2 reference(s)