Pacs1^{em5(PACS1*R201W)Lutzy}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pacs1^{em5(PACS1*R201W)Lutzy}
• Name: phosphofurin acidic cluster sorting protein 1; endonuclease-mediated mutation 5, Cathy Lutz
• MGI ID: MGI:7539214
• Synonyms: LSL-huPacs1-exon4 R201W
• Gene: Pacs1 Location: Chr19:5183714-5323138 bp, - strand Genetic Position: Chr19, 4.25 cM
• Alliance: Pacs1^{em5(PACS1*R201W)Lutzy} page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Humanized sequence)
• Mutations: Insertion, Nucleotide substitutions
• Mutation details: Guide RNAs (CCAGAGGGCCTGGTACTGCA,AGAAAGAAAGAAATGCCAGA,GGGCTATAAAACCTTAGCTG, and GGCTATAAAACCTTAGCTGT) are selected to excise and replace murine exon 4 with a human exon 4 containing the R201W (CGG to TGG, arginine to tryptophan, c.601) variant. A loxP-flanked STOP cassette, which contains a splice acceptor and 3x SV40 polyadenylation sequence is inserted into intron 3/4. Mouse Pcs1 transcript Pac1-201 (ENSMUST00000025786.9) and human PACS1-201 (ENST00000320580.9) were used as reference for the exon number and guide sequences. The mutation is orthologous to the human R203W mutation. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pacs1 Mutation: 46 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)