Lacc1^em1Flv
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lacc1^em1Flv
• Name: laccase domain containing 1; endonuclease-mediated mutation 1, Richard A Flavell
• MGI ID: MGI:7539559
• Synonyms: Lacc1^-
• Gene: Lacc1 Location: Chr14:77261640-77274344 bp, - strand Genetic Position: Chr14, 40.63 cM
• Alliance: Lacc1^em1Flv page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exons 3 and 7 were targeted with sgRNAs (targeting AAACTGCCATGAGACCTTACTGG and GTTAAGGCCATCGCGGACATGGG) using CRISPR/Cas9 technology, resulting in a deletion. (J:339910)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Lacc1 Mutation: 26 strains or lines available

References

• Original: J:339910 Wei Z, et al., LACC1 bridges NOS2 and polyamine metabolism in inflammatory macrophages. Nature. 2022 Sep;609(7926):348-353
• All: 1 reference(s)