Fastkd3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Fastkd3em1(IMPC)J |
Name: |
FAST kinase domains 3; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7543098 |
Gene: |
Fastkd3 Location: Chr13:68730353-68740457 bp, + strand Genetic Position: Chr13, 35.55 cM
|
Alliance: |
Fastkd3em1(IMPC)J page
|
IMPC: |
Fastkd3 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCATGGCGTTCATCACCCTG and TTTTTCCTTCAGCGGCTGCA, which resulted in a 1430 bp deletion beginning at Chromosome 13 position 68,583,568 bp and ending after 68,584,997 bp (GRCm38/mm10). This mutation deletes 1430 bp from ENSMUSE00000641296 (exon 2) and is predicted to cause a change of amino acid sequence after residue 2 and early truncation 2 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|