Mybpc3^em1Mtc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mybpc3^em1Mtc
• Name: myosin binding protein C, cardiac; endonuclease-mediated mutation 1, Michael T Chin
• MGI ID: MGI:7571382
• Synonyms: Mybpc3^Trunc, Mybpc3^Y838X
• Gene: Mybpc3 Location: Chr2:90948489-90966861 bp, + strand Genetic Position: Chr2, 50.44 cM, cytoband E1
• Alliance: Mybpc3^em1Mtc page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Single point mutation
• Mutation details: Tyrosine codon 845 (TAT) in exon 25 was changed to a stop codon (TAA) (ENSMUSP00000107058:p.Y845*) using an sgRNA (targeting CCTATGAGATGCGAGTCTACGCA) and an ssODN template with CRISPR/Cas9 technology. (J:342762)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mybpc3 Mutation: 42 strains or lines available

References

• Original: J:342762 Chou C, et al., A novel alphaB-crystallin R123W variant drives hypertrophic cardiomyopathy by promoting maladaptive calcium-dependent signal transduction. Front Cardiovasc Med. 2023;10:1223244
• All: 1 reference(s)