About   Help   FAQ
Csdc2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Csdc2em1(IMPC)J
Name: cold shock domain containing C2, RNA binding; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7574243
Gene: Csdc2  Location: Chr15:81820960-81835142 bp, + strand  Genetic Position: Chr15, 38.28 cM
Alliance: Csdc2em1(IMPC)J page
IMPC: Csdc2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GTTCCTGCTGACTATCCCTG and GTGAGGATACCGAGGCAGGG. This resulted in a 2,287 bp deletion of Chr15:81,946,521-81,948,807 (GRCm38/mm10) that removes exons ENSMUSE00000252667 and ENSMUSE00000556790. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Csdc2 Mutation:  11 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/17/2024
MGI 6.24
The Jackson Laboratory