Apoe^em1Aduci
Endonuclease-mediated Allele Detail

Summary

• Symbol: Apoe^em1Aduci
• Name: apolipoprotein E; endonuclease-mediated mutation 1, Frank LaFerla
• MGI ID: MGI:7622033
• Gene: Apoe Location: Chr7:19430034-19433113 bp, - strand Genetic Position: Chr7, 9.94 cM
• Alliance: Apoe^em1Aduci page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Using CRISPR/Cas9 technology, a guide RNA (gcacagaggagatacgggcg) was designed to produce a CGG to TCT missense mutation resulting in an arginine to serine mutation (R128S) in the apolipoprotein E (Apoe) gene. The missense mutation corresponds to the human SNP rs121918393 found in human APOE mature protein and is associated with an increased risk of Alzheimers disease (AD). (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Apoe Mutation: 151 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)