Mical1^em1Mean
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mical1^em1Mean
• Name: microtubule associated monooxygenase, calponin and LIM domain containing 1; endonuclease-mediated mutation 1, Mark E Anderson
• MGI ID: MGI:7628183
• Synonyms: MICAL1^R116H
• Gene: Mical1 Location: Chr10:41352310-41363028 bp, + strand Genetic Position: Chr10, 22.41 cM
• Alliance: Mical1^em1Mean page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Single point mutation
• Mutation details: Alanine codon 116 (CGT) in exon 3 was changed to histidine (CAT) (p.R116H) using an sgRNA (equivalent to AAAAGCGTATCAAGTTCTCTAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the encoded peptide unable to support F-actin depolymerization, while its ability to accelerate NADPH oxidation in the presence of Camk2 is unaffected. (J:299988)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mical1 Mutation: 50 strains or lines available

References

• Original: J:299988 Konstantinidis K, et al., MICAL1 constrains cardiac stress responses and protects against disease by oxidizing CaMKII. J Clin Invest. 2020 Sep 1;130(9):4663-4678
• All: 1 reference(s)