Ccdc96^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc96^em1(IMPC)J
• Name: coiled-coil domain containing 96; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7643196
• Gene: Ccdc96 Location: Chr5:36641932-36645515 bp, + strand Genetic Position: Chr5, 19.14 cM, cytoband B2
• Alliance: Ccdc96^em1(IMPC)J page

Mutation origin

• Strain of Origin: C57BL/6NJ

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GAAAATGGACAGCCACTACG and AGGGGTGAAGCAAAAGATCA. This resulted in a 1,724 bp deletion of Chr5:36,484,659-36,486,382 (GRCm38/mm10) that removes exon ENSMUSE00000346252. (J:23000)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ccdc96 Mutation: 21 strains or lines available

References

• Original: J:23000 MGD Nomenclature Committee, Nomenclature Committee Use. 1995-02-14
• All: 1 reference(s)