Alx4^em1Jian
Endonuclease-mediated Allele Detail

Summary

• Symbol: Alx4^em1Jian
• Name: aristaless-like homeobox 4; endonuclease-mediated mutation 1, Rulang Jiang
• MGI ID: MGI:7660788
• Synonyms: Alx4^f
• Gene: Alx4 Location: Chr2:93472779-93511686 bp, + strand Genetic Position: Chr2, 51.62 cM
• Alliance: Alx4^em1Jian page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: Using CRISPR/cas9 endonuclease-mediated genome editing, guide RNAs (AGAGGGGTCTTTAGCAGGTG and TTGCGTGGTGTTTAGCTGAG) were used to target to insert loxP into the introns flanking exon 2 of the aristaless-like homeobox 4 (Alx4) gene on chromosome 2. (J:349951)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Alx4 Mutation: 21 strains or lines available

References

• Original: J:349951 Lan Y, et al., Lineage-specific requirements of Alx4 function in craniofacial and hair development. Dev Dyn. 2024 Mar 13
• All: 1 reference(s)