Esf1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Esf1^em1(IMPC)J
• Name: ESF1 nucleolar pre-rRNA processing protein homolog; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7660950
• Gene: Esf1 Location: Chr2:139961803-140012484 bp, - strand Genetic Position: Chr2, 69.2 cM, cytoband G3
• Alliance: Esf1^em1(IMPC)J page
• IMPC: Esf1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GCATTACAATTAGCTTTTAT and ACATAATTATTGGCAACAAA. This resulted in a 677 bp deletion of region Chr2:140,164,161-140,164,837 (GRCm38/mm10) and removes exon ENSMUSE00000557773. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Esf1 Mutation: 43 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)