Txnrd1^em1Lgr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Txnrd1^em1Lgr
• Name: thioredoxin reductase 1; endonuclease-mediated mutation 1, Laura G Reinholdt
• MGI ID: MGI:7666123
• Gene: Txnrd1 Location: Chr10:82669785-82733546 bp, + strand Genetic Position: Chr10, 40.66 cM
• Alliance: Txnrd1^em1Lgr page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Using CRISPR/Cas9 technology, two sets of guide RNAs (gRNAs) were used (gRNA up 1:GGAGGCTGCAGCATCGCACT, gRNA down 1: GGGTTAATGATACTAGAGAT, gRNA up 2: GAGGCTGCAGCATCGCACTG, gRNA down 2: GGTTAATGATACTAGAGATA) to delete a 200-bp region containing the 75-bp SECIS translational regulatory element, as well as the flanking 3' UTR, of the thioredoxin reductase 1 (Txnr1) gene on chromosome 10. (J:348031)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Txnrd1 Mutation: 49 strains or lines available

References

• Original: J:348031 O'Connor C, et al., Unraveling the genetics of arsenic toxicity with cellular morphology QTL. PLoS Genet. 2024 Apr;20(4):e1011248
• All: 1 reference(s)