Prpf38a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prpf38a^em1(IMPC)J
• Name: PRP38 pre-mRNA processing factor 38 (yeast) domain containing A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7666157
• Gene: Prpf38a Location: Chr4:108422064-108436533 bp, - strand Genetic Position: Chr4, 50.64 cM
• Alliance: Prpf38a^em1(IMPC)J page
• IMPC: Prpf38a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: AAGCTTCTACATCTTGTGGA and CTACCGATCACGAGCTGTGA. This resulted in a 568 bp deletion of Chr4:108,575,138-108,575,705 (GRCm38/mm10) that removes exon ENSMUSE00000180481. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Prpf38a Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)