Acrv1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Acrv1^em1(IMPC)J
• Name: acrosomal vesicle protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7763937
• Gene: Acrv1 Location: Chr9:36604550-36610139 bp, + strand Genetic Position: Chr9, 20.67 cM
• Alliance: Acrv1^em1(IMPC)J page
• IMPC: Acrv1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TAACTCCTTCATTTTGATTT and CTTCTTGCTCTGACTTAGGC. This resulted in a 5,361 bp deletion of Chr9:36,693,302-36,698,662 (GRCm38/mm10) that removes exon ENSMUSE00000216596 through ENSMUSE00000395690. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Acrv1 Mutation: 11 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)