Cdk2ap1rt^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdk2ap1rt^em1(IMPC)J
• Name: cyclin dependent kinase 2 associated protein 1 retrotransposed; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7768066
• Gene: Cdk2ap1rt Location: Chr11:48716173-48717439 bp, - strand Genetic Position: Chr11, 28.8 cM
• Alliance: Cdk2ap1rt^em1(IMPC)J page
• IMPC: Cdk2ap1rt gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GGATGCCCAACAGCACTCAC and GAAAAACTTTGGCAAGTTGC. This resulted in a 1,453 bp deletion of Chr11:48,825,274-48,826,726 (GRCm38/mm10) that removes exon ENSMUSE00000665110. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cdk2ap1rt Mutation: 4 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)